温州医科大学学报
Home
|
About Journal
|
Editorial Board
|
Instruction
|
Subscribe
|
Messages Board
|
Contact Us
|
中文
温州医科大学学报
Forthcoming Articles
Current Issue
Archive
Advanced Search
Read Articles
Download Articles
Email Alert
2018 Vol. 48, No. 10
Published: 2018-10-25
703
In vitro culture identification and growth characteristics of rapidly aging SAMP6 mouse osteoblasts
WANG Jie, WANG Xiaofeng.
Objective: To study the mechanism of senile osteoporosis in SAMP6 mouse by in vitro isolation and culture of mouse osteoblasts derived from SAMP6 mouse. Methods: The skull of neonatal SAMP6 mice was isolated by mechanical separation. SAMP6 mouse osteoblasts were cultured by enzyme digestion. The morphology of SAMP6 mouse osteoblasts was observed by alkaline phosphatase (ALP) staining and Wright-Jimeza staining. SAMP6 mouse osteoblasts was identified by the staining of calcified nodules with safranin. Results: In this experiment, the growth curve of osteoblasts in SAPM6 mouse was shown as follows: 1~3 days was the latent adaptation period of osteoblasts in SAMP6 mouse, and it entered the logarithmic growth phase of cells in 3 to 7 days, and then became the plateau phase. The SAMP6 mouse osteoblast cultured in vitro was stained by R-J and observed by microscope. The cytoplasm showed blue particles, and the nucleus was stained with purple-brown, with an average of 1-3 nucleoli. ALP stained microscopy showed that the distribution of purple particles in the cytoplasm, alizarin red staining could be seen in the naked eye and the calcified orange nodules, indicating that isolation and culture of SAMP6 mouse cells were experimental osteoblasts. Conclusion: The osteoblasts of SAMP6 neonatal mouse isolated and cultured in vitro in this experiment were initially qualified and basically corresponded with the characteristics of osteoblasts, which has laid foundations for the mechanism study of SAMP6 mouse mimicking senile osteoporosis.
2018 Vol. 48 (10): 703-707 [
Abstract
] (
792
)
HTML
(1 KB)
PDF
(1440 KB) (
784
)
708
Screening for novel peptides specifically binding to the surface of endometriosis cells
YAN Linzhi, CAO Dan, WANG Ledan, LI Wenju, LYU Jieqiang.
Objective: A 7-mer phage display library was employed to isolate novel peptides that specifically bind to the surface of ectopic endometrium cells in vitro. Methods: Phage display technology with biopanning and rapid analysis of selective interactive ligands between ectopic and eutopic endometrium cells was utilized. After five rounds of biopanning, 50 phage clones were randomly selected and analyzed by enzyme-linked immunosorbent assay and DNA sequencing. A peptide-competitive inhibition assay was performed to identify the affinity of positive phages toward ectopic endometrium cells. Results: ①After ELISA, the OD450 value of 13 clones was >0.5, and these phase clones were sequenced. Six distinct sequences out of 13 clones were obtained and 5 clones had a consensus DNA sequence CGCACCCGCCTGCATACCCGC, with a corresponding amino acid sequence of RTRLHTR. ②The binding capacity of the polypeptide RTRLHTR for endometriosis cells was reduced in a peptide dose-dependent pattern. In contrast, the control peptide revealed no such specific binding activity. Conclusion: The polypeptide RTRLHTR screened by phage display technology may offer a new direction for early diagnosis and treatment of endometriosis.
2018 Vol. 48 (10): 708-711 [
Abstract
] (
665
)
HTML
(1 KB)
PDF
(1337 KB) (
778
)
712
The effect of tranexamic acid administration on the endothelial glycocalyx degradation in vascular endothelial cell at different time
HU Lei
Objective: To investigate the effect of tranexamic acid (TXA) on glycocalyx damage in human umbilical vein endothelial cells (HUVECs) following H2O2 injury. Methods: In vitro HUVECs were exposed to H2O2 to stimulate post-shock reperfusion. TXA was added during H2O2 incubation (30 minutes and 60 minutes) and at 1 hour and 2 hours before the termination of H2O2 exposure. The cellular morphology was observed using a fluorescence microscope after Hoechst 33258 staining. Endothelial cell injury was indexed by caspase-3 as well as ICAM expression and TNF-α release. Glycocalyx degradation was indexed by syndecan and HLA release. Activation of endothelial sheddases was indexed by MMP-9 content in HUVECs. Transwell assay was performed to explore the invasive property of HUVECs. Results: Exposure of HUVECs to H2O2 results in glycocalyx disruption demonstrated by promoted apoptosis and increased levels of caspase-3, syndecan, HLA, TNF-α, ICAM and MMP-9. TXA administration within 60 minutes of H2O2 treatment results in preservation of the glycocalyx. TXA administration after 60 minutes is no glycocalyx protective effect on HUVECs. Conclusion: TXA is exerted as an endothelial protector via inhibition of glycocalyx degradation. This effect is not apparent when TXA was administered after 60 minutes of H2O2 exposure.
2018 Vol. 48 (10): 712-717 [
Abstract
] (
682
)
HTML
(1 KB)
PDF
(1502 KB) (
886
)
718
Correlation between PD-L1 protein expression and BRAF V600E gene mutation in papillary thyroid carcinoma
LUO Huarong, GAN Meifu, XU Cheng, XU Weiming, LIANG Yong
Objective: To investigate the correlation between PD-L1 protein expression and BRAF V600E gene mutation in papillary thyroid carcinoma (PTC). Methods: 74 cases of PTC and normal thyroid tissue specimens were used to detect PD-L1 protein expression by immunohistochemical EnVision two step method. Gene mutation of BRAF V600E was detected by Q-PCR. And the correlation between PD-L1 protein expression and the clinicopathological parameters of PTC including BRAF V600E gene mutation was evaluated. Results: The positive rate of PD-L1 protein expression was 48.6% (36/74) in PTC tissues, significantly higher than that in control group (P<0.01). The expression of PD-L1 protein was correlated with age, tumor size, chronic lymphocytic thyroiditis (CLT) background, tumor-infiltrating lymphocytes (TILs) and clinical stage (P<0.05). The positive rate of BRAF V600E gene mutation was 79.7% (59/74) in PTC tissues. The gene mutation of BRAF V600E was correlated with histological classification of PTC (P<0.01). Consistency analysis showed that there was no relationship between PD-L1 protein expression and BRAF V600E gene mutation (Kappa=-0.091, P>0.05). Among these parameters, background CLT was independent factor affecting PD-L1 protein expression (OR=18.675, 95%CI: 3.074~113.453, P<0.01). Conclusion: PD-L1 protein is over-expressed in PTC tissues. The expression of PD-L1 protein is correlated with clinicopathologic features of PTC, but there is no relationship between PD-L1 protein expression and BRAF V600E gene mutation in PTC.
2018 Vol. 48 (10): 718-722 [
Abstract
] (
857
)
HTML
(1 KB)
PDF
(1323 KB) (
818
)
723
The association between dyslipidemia and family history of diabetes in normoglycemic population
HU Xiang, GU Xuejiang, YANG Lijuan, LIN Yi, YU Weihui, SI Qiya
Objective: The normoglycemic first-degree relatives of patients with diabetes (FDR) are preferable for studies investigating metabolic abnormalities in the early stage of diabetes. The goal of the present study was to explore the association between the family history of diabetes and dyslipidemia. Methods: The present study population was selected from baseline survey of REACTION study in Wenzhou City. FDR was defined as having one or more first-degree relatives of patients with diabetes (parent, sibling, or offspring. Dyslipidemia was defined according to the Chinese guidelines on prevention and treatment of dyslipidemia in adults. The participants were divided into non-FDR and FDR groups based on their family history of diabetes. Comparisons of the prevalence of dyslipidemia and the levels of related metabolic indexes were conducted between these two groups. Results: Compared with non-FDR, FDR exhibited higher serum levels of TC, TG, and LDL-c, but lower levels of HDL-c (both P<0.05). The prevalence of dyslipidemia was greater in FDR (P<0.001). Multivariate analysis showed that TG, LDL-c, and HDL-c (both P<0.05) were associated with the first-degree family history of diabetes independently. Logistic regression analysis revealed the independent association between the first-degree family history of diabetes and the present of dyslipidemia (P<0.001). Conclusion: FDR are prone to dyslipidemia even with normal glucose tolerance and weight. First-degree family history of diabetes is an independent risk factor of the present of dyslipidemia.
2018 Vol. 48 (10): 723-726,730 [
Abstract
] (
672
)
HTML
(1 KB)
PDF
(1390 KB) (
692
)
727
Clinical effect of early thawed frozen embryo in the 3rd day cultured in the 5th day
XI Haitao, CHEN Hua, ZHANG Fan, LIU Xiaoming, FU Yanghua, ZHAO Junzhao.
Objective: To examine the clinical transplantation outcomes of cleavage stage embryos thawed 2 days earlier for culture, in order to confirm the development potential of cryopreserved cleavage stage embryos. Methods: In this prospective clinical study, 122 cycles of ART treatment for infertility have been evaluated. Frozen embryos in blastocyst group thawed and then cultured in sequential media until blastocyst stage were compared with thawed embryos in cleavage stage group. Results: Clinical rates was significantly higher in blastocyst group (66.67%) compared with cleavage group (37.5%). No statistical differences were reported in implantation rates between the two groups. Conclusion: The results indicated that blastocyst formation after thawing of cleavage stage embryos is a good predictor for embryo viability and pregnancy outcome.
2018 Vol. 48 (10): 727-730 [
Abstract
] (
834
)
HTML
(1 KB)
PDF
(1289 KB) (
887
)
731
A new cervical cytology brush and its clinical application in cervical cancer screening
SHENG Bo, TU Quanmei, ZHU Xueqiong
Objective: To introduce a new type of cervical cytology brush and to investigate its clinical application in the cervical cancer screening. Methods: The structure and operating principles of this new cervical cytology brush were described in detail. Thirty women with abnormal cytology or high-risk human papillomavirus (HPV) positive via the traditional cytology brush in the Second Affiliated Hospital of Wenzhou Medical University from March 2017 to January 2018 were selected. According to instructions, samples of cervical exfoliate cells were collected using a new cytology brush later. The rates of satisfactory cytology specimen, abnormal cytology and HPV positive in two groups were evaluated. Results: The satisfaction rates of cervical cytology specimen using the new and traditional cytology brush was both 100%. Twenty-three women (76.7%) had abnormal cytology and twenty-five women (83.3%) tested high-risk HPV positive in the traditional cytology brush group. The rates of abnormal cytology and high-risk HPV positive were 63.3% and 76.7%, respectively, in the new cytology brush group. The consistency analysis showed good agreement (kappa>0.75). Conclusion: The new type of cervical cytology brush could effectively collect samples of cervical exfoliate cells. It performed similarly to the traditional cervical cytology brush in identifying abnormal cytology and high-risk HPV in cervical cancer screening. Our data suggested that the new cervical cytology brush could be an alternative, more convenient and efficient strategy for cervical cancer screening as compared to traditional cytology brush.
2018 Vol. 48 (10): 731-734 [
Abstract
] (
649
)
HTML
(1 KB)
PDF
(1291 KB) (
842
)
735
Identification of lung adenocarcinoma in situ and minimally invasive adenocarcinoma based on CT GE Lung VCAR software
JI Xiaowei, FU Gangze, LI Wenbin, YANG Yunjun, CHEN Cong, CAI Mengting, WU Enfu.
Objective: The CT identification of lung adenocarcinoma in situ (AIS) and minimally invasive adenocarcinoma (MIA) was analyzed by using GE Lung VCAR software. Methods: The CT images of 50 AIS patients and 55 MIA patients from the First Affiliated Hospital of Wenzhou Medical University were analyzed by GE Lung VCAR software after taking three-dimensional computed tomographic segmentation of lung nodules. The differences between AIS and MIA solid portion and their overall left-right diameter (LRD), anteroposterior diameter (APD), suprainferior diameter (SID), Average Density (DAVG), Non-Solid portion Volume (VNS), Solid portion Volume (VS), Total Volume (VT), percentage of Solid portion Volume (VS%), morphological features were compared. The diagnostic effectiveness of the two-dimensional manual measurements of nodule maximum diameter were compared to assess the diagnostic value of GE Lung VCAR software. Results: There’s statistical difference (P<0.05) between two-dimensional manual measurement of the maximum diameter and software analysis of the AIS group and the MIA group to obtain the solid nodule and the total three-segment, VS, VT, VS%, nodular morphology, burr sign, nodule-vessel relationship, number of vessel involvement. GE Lung VCAR software showed high diagnostic efficiency compared with manual measurement on nodule size. The diagnostic efficiency from high to low ranked as follows: involved vessel amount, spicule sign, overall LRD, solid APD, VT, VS. The optimal cutoff values were: three involved vessels, short spicule sign, overall LRD: 14.5 mm, solid APD: 8.5 mm, VT: 802 mm3, VS: 133 mm3. Conclusion: GE Lung VCAR software has practical value in the CT diagnosis of ground glass nodule. It is a useful supplement to identify AIS and MIA.
2018 Vol. 48 (10): 735-740,745 [
Abstract
] (
767
)
HTML
(1 KB)
PDF
(1722 KB) (
895
)
741
Asymmetry of bilateral kidney density of unilateral ureteral calculi
YU Ling’an, HUANG Danjiang, Han Yingmin, Zhang Lingmin
Objective: To investigate the difference in CT value density of bilateral kidneys in patients with unilateral ureteral calculi. Methods: A total of 119 patients with unilateral ureteral calculi treated in Taizhou First People’s Hospital from December 2013 to January 2017 were selected as observation group and in the same period, 80 healthy volunteers were recruited as the control group. CT values of renal parenchyma on the lesion and the healthy sides were measured, and the ratio of CT values (CTlesion/CThealthy) was calculated. The ROC curve was drafted to analyze the optimal diagnostic value of the CT ratio. According to the position of calculi, the observation group was divided into upper ureteral calculi group, middle ureteral calculi group and lower ureteral calculi group. According to the clinical classification of the stone size (I type: I type: ≤5 mm;II type: 6~9 mm; III type:≥10 mm), the observation group was further divided into I type group, II type group and III type group. Results: The average values of CTlesion/CThealthy in the unilateral ureteral calculi group (84.43%±6.17%) was significantly lower than the control group (96.02%±2.03%) (P<0.01). The area under the ROC curve of CTlesion/CThealthy was 0.981 and optimal diagnostic threshold was 93.10%. The corresponding sensitivity, specificity, accuracy, positive predictive value and negative predictive value were 98.8%, 94.3%, 97.29%, 97.16% and 97.55% respectively. There was no significant difference among the position groups. There was no significant difference among the stone size groups, either. Conclusion: The decrease in CT ratio of the bilateral kidney is one of the reliable secondary signs of unilateral ureteral calculi, but it is not affected by the position and size of ureteral calculi.
2018 Vol. 48 (10): 741-745 [
Abstract
] (
638
)
HTML
(1 KB)
PDF
(1397 KB) (
822
)
746
Clinical features and prognosis of systemic-onset juvenile idiopathic arthritis
YANG Kangkang, YE Xiaohua, SHANGGUAN Yaoyao, ZHENG Wenjie
Objective: To analyze the clinical features of children with systemic-onset juvenile idiopathic arthritis (SoJIA). Methods: Patients diagnosed with SoJIA from January 2010 to January 2017 were evaluated and data were collected for clinical analysis. Results: A total of 41 patients (28 boys and 13 girls) were included in this study. The mean age of onset was (7.35± 3.17) years old. The most common presentations were fever (100%), arthritis (80.5%), and skin rash (58.5%). Macrophage activation syndrome was found in 6 cases. Oligoarticular type of arthritis accounted for 87.9% of the affected patients. The mean period from the first day of clinical symptoms to that of developing arthritis was 220 days (545 days, 112 days, 125 days, 120 days, and 200 days respectively), and the patterns of arthritis were all oligoarticular type. The most common joints involved were the knee, ankle, shoulder and elbow. Leukocytosis and anemia accounted for 68.3%, and 43.9% respectively. The majority of inflammatory parameters, including CRP, ESR and SF were elevated. 44.8% of patients had single-phase course, 17.2% had relapsing once and 37.9% had relapsing at least twice. After therapy, 25 cases achieved complete reminssion, 12 cases failed to follow-up, and 1 case was dead. Relapsing group was significantly younger. The levels of CRP, SF, ALT, CD3+, CD4+ and GGT in the relapsing group were significantly lower. Conclusion: The clinical manifestations of SoJIA were various, 12.2% of patients did not have arthritis on disease onset, but developed arthritis during follow-up process. Most prognosis is good. The younger onset age, thrombocytosis and T lymphocyte dysfunction may indicate a relapsing course.
2018 Vol. 48 (10): 746-749 [
Abstract
] (
743
)
HTML
(1 KB)
PDF
(1292 KB) (
846
)
750
Effect of bufalin and histone deacetylase inhibitor SAHA in multiple myeloma cells
HUANG He, ZHOU Shuping, GUO Wenjian, YAO Rongxin, LIN Ying.
Objective: To investigate bufalin combined with histone deacetylase (HDAC) inhibitor SAHA on growth inhibition and apoptosis of multiple myeloma cell lines. Methods: CCK-8 and flow cytometry (RH-123, PI staining) assay were used to assess the effects of bufalin on induction of apoptosis in multiple myeloma (MM) cells. Then, CCK-8 assay was carried out to examine the effects of SAHA in single or in combination of bufalin, on the inhibition of proliferation in MM cells. Results: Bufalin exerted remarkable effects on growth suppression of multiple myeloma cells NCI-H929, U266 and CZ-1, with the concentration of IC50 about 10-20 nmol/L. Cell cycle distribution was determined by flow cytometry analysis of DNA content, indicating bufalin mainly caused S and G2-M arrest in H929, U266 and RPMI8226 cells. Furthermore, it was investigated that bufalin could induce MM cells apoptosis through mitochondrial damage and SAHA could inhibit the growth of MM cells. When H929 cells treated with these two agents for 48 h, it was found 10 nmol/L bufalin decreased about 30% viability of cells at various concentrations of SAHA, showing statistical difference when compared with these drugs in single use. Conclusion: Bufalin as well as SAHA exhibited anti-MM cells by suppression of cellular proliferation and the induction of apoptosis. And the cytocidal effects of bufalin and SAHA were significantly enhanced when the two agents were in combination even at lower concentrations.
2018 Vol. 48 (10): 750-753,758 [
Abstract
] (
691
)
HTML
(1 KB)
PDF
(1558 KB) (
757
)
754
The regional homogeneity of brain function in patients with mild cognitive impairment with depressive symptoms
Chen Jiuzhun, Zhou Shengfa, Lin Feng, He Chengbin, Che Canwen.
Objective: To investigate the local consistency of brain function in patients with mild cognitive impairment with depressive symptoms. Methods: We scanned 16 patients with MCI with depressive symptoms and 18 MCI patients without depressive symptoms (nD-MCI) using the 3.0T MR scanner and obtained rs-fMRI data. Statistical analysis was used to assess the different regions of CReHo between the two groups. And the correlation between CReHo index and clinical scale was analyzed to evaluate the correlation between CReHo and pathophysiological indicators. Results: The CReHo value of the left Heschl and right thalamus areas in the D-MCI group was significantly higher than that in the non-depressive group, while the CReHo value of the left posterior central gyrus was reduced. In addition, our study also showed that the CReHo value of the left thalamus was positively correlated with the Hamilton Depression Scale (HAMD) score of D-MCI patients. Conclusion: These findings suggest that abnormal sensory motor network may be one of the main pathophysiological factors of D-MCI.
2018 Vol. 48 (10): 754-758 [
Abstract
] (
670
)
HTML
(1 KB)
PDF
(1354 KB) (
909
)
759
The effect of acetate sodium against gastric mucosal lesion of mice and its underlying mechanism
SHI Yilu, ZHANG Jiali, QIAO Wanning, CHEN Jie, SU Wei, ZHANG Zhengzheng, DONG Renjie, WANG Fangyan, HUANG Yingpeng
Objective: To observe the effect of acetate sodium on the gastric mucosal lesion induced by ethanol and investigate the underlying mechanism. Methods: Mice were randomly divided into normal control group, model group and acetate sodium group. The gastric mucosal inflammation model was made by intragastric administration of ethanol. The inflammatory cytokines IL-1β, TNFα and MCP-1 were detected by real time quantitative PCR (RT-qPCR). CCK-8 was detected to evaluate the effect of acetate on the alcohol-induced injury of GES-1 which is normal cell line of human gastric mucosa. We also observed the effect of acetate sodium on the LPS-induced inflammation in the mice macrophage cell line J774 by detecting the inflammatory cytokines, IL-1β, TNFα and MCP-1. Results: Compared with normal control group, the ethanol stimulation significantly induced gastric mucosal lesion. However, acetate sodium dramatically reduced this lesion. The RT-qPCR results showed that the increased expressions of IL-1β, TNFα and MCP-1 after ethanol administration were obviously attenuated by acetate sodium (P<0.01). CCK-8 results indicated that acetate was significantly protective against the lesion induced by alcohol. The results of in vitro inflammation experiment on J774 showed that acetate sodium reduced the up-regulated expressions of IL-1β, TNFα and MCP-1 (P<0.01). Conclusion: Acetate sodium can attenuate ethanol-induced in gastric mucosal lesion. The anti-inflammation and protection against acetate in gastric mucosa play important roles in the corresponding mechanism.
2018 Vol. 48 (10): 759-763 [
Abstract
] (
763
)
HTML
(1 KB)
PDF
(1441 KB) (
829
)
764
The effect of combined treatment of Chinese and western medicine on perioperative inflammation of fracture
YU Neng, FANG Lue, HUANG Xiaotao, YAN Limin, ZHANG Chi, ZHOU Jiaen, XIE Changfa.
Objective: To explore the clinical curative effect of combined traditional Chinese medicine and western medicine in the treatment of infection in perioperative period of fracture. Methods: A total of 80 patients with closed fractures of extremities (upper and lower limbs) in Cixi Traditional Chinese Medicine Hospital from October 2014 to March 2016 were included. They were divided into the control group (clinical routine medicine) and the observation group (traditional Chinese medicine combined with clinical routine medicine). For each group of patients, C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), white blood cell count (WBC), neutrophil (NEU) ratio, tumor necrosis factor-α (TNF-α), interleukin-1 (IL-1) and interleukin-6 (IL-6) were measured. Results: The CRP, ESR, WBC, NEU ratio, TNF-α, IL-1, IL-6 of the control group and observation group were the highest at 1 day after operation, then decreased at 5 days after operation, the difference was statistically significant (P<0.01). And the decrease of the observation group was more obvious. It was found in the late follow-up that there were 2 cases of infection in the control group and no infection patients in the observation group. Conclusion: The combined treatment of traditional Chinese medicine and Western medicine in perioperative period of fracture can decrease the inflammatory medium release, which may produce and added effect on the prevention of infection.
2018 Vol. 48 (10): 764-768 [
Abstract
] (
678
)
HTML
(1 KB)
PDF
(1302 KB) (
783
)
769
Assessment of the ability of computed diffusion-weighted imaging to improve the conspicuousness of brain tumors
CHEN Zhongwei, ZHAO Youfan, YE Qiong, ZHANG Zhao, XUE Yingnan, CHEN Yongchun, LI Jiance.
Objective: To assess the ability of computed diffusion-weighted imaging (cDWI) to improve the conspicuousness of brain tumors. Methods: Twenty-four patients with brain tumors (15 male and 9 female, ranging from 13 to 73 in age) who had undergone multi-parameters MRI examinations at 3.0T followed by surgery with the interval less than one month were included in this study. 2 b values DWI was used to synthesize images acquired by computed diffusion weighted imaging (cDWI) at b values of 1 500, 2 000, 2 500, 3 000, 3 500, 4 000 s/mm2. Regions of interest (ROIs) were placed on tumor lesions, peritumoral edema regions and normal-appearing white matter regions, respectively. The signal intensity of ROIs were measured and compared. The contrast ratio (CR) between tumor lesions and normal-appearing white matter regions (CRn) and that between tumor lesions and peritumoral edema regions (CRe) in cDWI images were both compared with measured DWI images. Results: The standardized contrast ratios between tumor and peritumoral edema in cDWI images at b values of 2 500, 3 000, 3 500 and 4 000 s/mm2 were significantly higher than that in measured DWI images at b values of 1 000 s/mm2 (mDWI 1 000) (P<0.05). Conclusion: The high b-value cDWI images could enhance the contrast between brain tumor and the peritumoral edema regions, which has showed potential for the detection of peritumoral invasion of malignant tumor.
2018 Vol. 48 (10): 769-772 [
Abstract
] (
702
)
HTML
(1 KB)
PDF
(1358 KB) (
957
)
776
The effect of tetracaine hydrochloride mucilage on the pain relief in patients with maintenance hemodialysis
WU Yaoyao, HUANG Wen, YE Bairu, XU Wumin
Objective: To explore the effect of tetracaine hydrochloride mucilage on the relief of pain in maintenance hemodialysis patients. Methods: Totally 80 hemodialysis patients using fistula were divided into two groups equally: puncture group as control and tetracaine hydrochloride mucilage group as experiment group. Numerical rating scale and Faces rating scales were used to record the pain scores. Satisfaction questionnaire was handed out to the patients and the data from those two groups were compared. Another 20 hemodialysis patients with two successive dialysis session were recruited. In these patients, routine puncture was performed initially, and then tetracaine hydrochloride mucilage was applied to the fistule for the next successive hemodialysis session. Blood pressure before and after the puncture at different times were compared. Results: Pain scale was significantly lower in the experiment group (P<0.05) while the satisfaction rate was higher compared with the control group. There were differences in systolic and diastolic pressure in 20 patients for the first time using routine puncture respectively (P<0.05). However, the difference in blood pressure was not significant in the 20 patients for the next dialysis session (P>0.05). The systolic and diastolic pressure before and after puncture showed significant difference for the first and second time of hemodialysis session respectively in 20 hemodialysis patients. Conclusion: The use of tetracaine hydrochloride mucilage could relieve pain, increase the satisfaction rate and decrease the fluctuation of blood pressure, thus alleviating anxiety and promoting the patients’ compliance to the treatment of hemodialysis.
2018 Vol. 48 (10): 776-778 [
Abstract
] (
640
)
HTML
(1 KB)
PDF
(1286 KB) (
816
)
Copyright © Editorial Board of JOURNAL OF WEZHOU MEDICAL UNIVERSITY
Supported by:
Beijing Magtech